Reaction of aflatoxin B1 exo-8,9-epoxide with DNA: kinetic analysis of covalent binding and DNA-induced hydrolysis.
نویسندگان
چکیده
The exo isomer of aflatoxin B1 (AFB1) 8,9-epoxide appears to be the only product of AFB1 involved in reaction with DNA and reacts with the N7 atom of guanine via an SN2 reaction from an intercalated state. Although the epoxide hydrolyzes rapidly in H2O (0.6 s-1 at 25 degrees C), very high yields of DNA adduct result. Experimental binding data were fit to a model in which the epoxide forms a reversible complex with calf thymus DNA (Kd = 0.43 mg ml-1, or 1.4 mM monomer equivalents) and reacts with guanine with a rate of 35 s-1. Stopped-flow kinetic analysis revealed attenuation of fluorescence in the presence of DNA that was dependent on DNA concentration. Kinetic spectral analysis revealed that this process represents conjugation of epoxide with DNA, with an extrapolated rate maximum of 42 s-1 and half-maximal velocity at a DNA concentration of 1.8 mg ml-1 (5.8 mM monomer equivalents). The rate of hydrolysis of the epoxide was accelerated by calf thymus DNA in the range of pH 6-8, with a larger enhancement at the lower pH (increase of 0.23 s-1 at pH 6.2 with 0.17 mg DNA ml-1). The same rate enhancement effect was observed with poly[dA-dT].poly[dA-dT], in which the epoxide can intercalate but not form significant levels of N7 purine adducts, and with single-stranded DNA. The increased rate of hydrolysis by DNA resembles that reported earlier for epoxides of polycyclic hydrocarbons and is postulated to involve a previously suggested localized proton field on the periphery of DNA. The epoxide preferentially intercalates between base pairs, and the proton field is postulated to provide acid catalysis to the conjugation reaction.
منابع مشابه
Structural characterization of the major adducts obtained after reaction of an ultimate carcinogen aflatoxin B1-dichloride with calf thymus DNA in vitro.
The major adduct formed on acid hydrolysis of calf thymus DNA which has been reacted with 8,9-dichloro-8,9-dihydroaflatoxin B1, a chemical model of the ultimate carcinogen 8,9-dihydro-8,9-epoxyaflatoxin B1 (AFB1-epoxide), has been characterized by proton nuclear magnetic resonance and fast atom bombardment mass spectroscopy. This adduct has been identified as an N7-substituted guanine adduct an...
متن کاملDNA-damaging effects of genotoxins in mixture: modulation of covalent binding to DNA.
Modulation of DNA adduct formation by pre-existing adducts was examined in synthetic oligonucleotides and genomic DNA (calf thymus); genotoxins studied were N-acetoxy-acetylaminofluorene (N-AcO-AAF), aminofluorene (AF), aflatoxin B1-8,9-epoxide (AFB1-8,9-epoxide), and dimethylsulfate (DMS). Oligodeoxynucleotides containing either guanine-C8-AAF (Gua-C8-AAF) or Gua-C8-AF adducts and a neighborin...
متن کاملInvolvement of cytochrome P450, glutathione S-transferase, and epoxide hydrolase in the metabolism of aflatoxin B1 and relevance to risk of human liver cancer.
In recent years there has been considerable interest in the effect of variations in activities of xenobiotic-metabolizing enzymes on cancer incidence. This interest has accelerated with the development of methods for analyzing genetic polymorphisms. However, progress in epidemiology has been slow and the contributions of polymorphisms to risks from individual chemicals and mixtures are often co...
متن کاملSite-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.
The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 for...
متن کاملEditor’s Highlight: Pregnancy Alters Aflatoxin B1 Metabolism and Increases DNA Damage in Mouse Liver
Pregnancy is a complex physiological state, in which the metabolism of endogenous as well as exogenous agents is ostensibly altered. One exogenous agent of concern is the hepatocarcinogen aflatoxin B1 (AFB1), a foodborne fungal toxin, that requires phase I metabolic oxidation for conversion to its toxic and carcinogenic form, the AFB1-8,9-exo-epoxide. The epoxide interacts with cellular targets...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- Proceedings of the National Academy of Sciences of the United States of America
دوره 94 12 شماره
صفحات -
تاریخ انتشار 1997